Home   Guide to ATMT Database   Sitemap   Contact  
Sequence ID  5337981
Locus Name  MGG_07736.5
Gene Name  
Protein Name  hypothetical protein
Species Name  Magnaporthe grisea [Magnaporthe oryzae 5 PROTEINS]
Protein Sequence
[286 aa]
+  1
101
201

MNNLQTLPRFLLPRLSWQTPATASDCTFRPASLLLRPSKRPHIQERREPQQQSWAGPKRLFHTHNEGQRAHAIGFQSHRLARQPTASPKPRIPSSRRAFHASPPRRKDHHFDTLKLVQRLQSEGFTETQAEAMMKILNDVIEESIQNLTRTMVPREDAAKATYTQKVDFAKLRSELLSTDNTETNTTRAAHERLTNDIAKLSSRLRDEIGRTQASVRLDLNLEKGRIREEAVSQELKIKETETKIEQEAAALRQQLEQVKFQTLQWLMGLCTGFAALMLGLWRLLM
ASPPRRKDHHFDTLKLVQRLQSEGFTETQAEAMMKILNDVIEESIQNLTRTMVPREDAAKATYTQKVDFAKLRSELLSTDNTETNTTRAAHERLTNDIAK

DNA Sequence
[861 bp]
+  1
101
201
301
401
501
601
701
801
ATGAACAACCTACAAACACTCCCCCGATTCCTTCTCCCCCGTCTGAGCTGGCAGACCCCAGCCACTGCAAGCGACTGTACATTCCGCCCGGCAAGCCTCTTGCTGCGCCCATCAAAAAGGCCTCATATCCAGGAGCGGAGGGAGCCGCAGCAGCAATCTTGGGCAGGTCCCAAACGACTATTTCACACTCACAATGAAGGGCAAAGGGCGCATGCTATCGGCTTCCAGAGCCACCGATTGGCGAGGCAGCCAACGGCTTCACCCAAGCCTAGAATCCCAAGCAGCAGGAGAGCATTCCATGCCTCGCCGCCCCGCCGGAAGGATCATCACTTTGATACCCTGAAGCTGGTCCAGCGGCTGCAGAGTGAGGGCTTCACCGAGACGCAGGCAGAAGCCATGATGAAGATCTTGAACGATGTAATAGAGGAGAGCATACAAAATCTCACCCGCACAATGGTCCCGCGCGAGGACGCCGCCAAGGCCACGTACACGCAAAAGGTCGACTTTGCCAAGCTCCGCAGCGAGCTGCTGTCGACGGACAACACCGAGACCAACACGACTCGCGCCGCGCATGAGCGCCTGACTAACGACATTGCCAAGCTCAGCAGCCGGCTGCGCGACGAGATTGGCCGCACTCAGGCCAGCGTTCGCCTGGACCTGAACCTGGAGAAGGGCCGCATCCGCGAGGAGGCCGTGTCGCAGGAACTCAAGATCAAGGAGACCGAGACCAAGATCGAGCAGGAGGCCGCCGCCCTGAGGCAGCAGCTCGAGCAGGTCAAGTTCCAGACCCTGCAGTGGCTCATGGGGCTTTGCACCGGATTTGCTGCGCTCATGTTGGGTCTGTGGCGTTTGTTGATGTGA
TGCTGCGCCCATCAAAAAGGCCTCATATCCAGGAGCGGAGGGAGCCGCAGCAGCAATCTTGGGCAGGTCCCAAACGACTATTTCACACTCACAATGAAGG
GCAAAGGGCGCATGCTATCGGCTTCCAGAGCCACCGATTGGCGAGGCAGCCAACGGCTTCACCCAAGCCTAGAATCCCAAGCAGCAGGAGAGCATTCCAT
GCCTCGCCGCCCCGCCGGAAGGATCATCACTTTGATACCCTGAAGCTGGTCCAGCGGCTGCAGAGTGAGGGCTTCACCGAGACGCAGGCAGAAGCCATGA
TGAAGATCTTGAACGATGTAATAGAGGAGAGCATACAAAATCTCACCCGCACAATGGTCCCGCGCGAGGACGCCGCCAAGGCCACGTACACGCAAAAGGT
CGACTTTGCCAAGCTCCGCAGCGAGCTGCTGTCGACGGACAACACCGAGACCAACACGACTCGCGCCGCGCATGAGCGCCTGACTAACGACATTGCCAAG
CTCAGCAGCCGGCTGCGCGACGAGATTGGCCGCACTCAGGCCAGCGTTCGCCTGGACCTGAACCTGGAGAAGGGCCGCATCCGCGAGGAGGCCGTGTCGC
AGGAACTCAAGATCAAGGAGACCGAGACCAAGATCGAGCAGGAGGCCGCCGCCCTGAGGCAGCAGCTCGAGCAGGTCAAGTTCCAGACCCTGCAGTGGCT
Position in Contig 109375 ~ 110315 (941 bp, 80 bp) in Magnaporthe grisea 70-15 supercontig 5.183 (Strand +) (Frame : 1)
Chromosome Chromosome : Not defined!
Contig Sequence
(99301 ~ 120300)

+ 99301
99401
99501
99601
99701
99801
99901
100001
100101
100201
100301
100401
100501
100601
100701
100801
100901
101001
101101
101201
101301
101401
101501
101601
101701
101801
101901
102001
102101
102201
102301
102401
102501
102601
102701
102801
102901
103001
103101
103201
103301
103401
103501
103601
103701
103801
103901
104001
104101
104201
104301
104401
104501
104601
104701
104801
104901
105001
105101
105201
105301
105401
105501
105601
105701
105801
105901
106001
106101
106201
106301
106401
106501
106601
106701
106801
106901
107001
107101
107201
107301
107401
107501
107601
107701
107801
107901
108001
108101
108201
108301
108401
108501
108601
108701
108801
108901
109001
109101
109201
109301
109401
109501
109601
109701
109801
109901
110001
110101
110201
110301
110401
110501
110601
110701
110801
110901
111001
111101
111201
111301
111401
111501
111601
111701
111801
111901
112001
112101
112201
112301
112401
112501
112601
112701
112801
112901
113001
113101
113201
113301
113401
113501
113601
113701
113801
113901
114001
114101
114201
114301
114401
114501
114601
114701
114801
114901
115001
115101
115201
115301
115401
115501
115601
115701
115801
115901
116001
116101
116201
116301
116401
116501
116601
116701
116801
116901
117001
117101
117201
117301
117401
117501
117601
117701
117801
117901
118001
118101
118201
118301
118401
118501
118601
118701
118801
118901
119001
119101
119201
119301
119401
119501
119601
119701
119801
119901
120001
120101
120201
TTGCGGTTCTGGCGCAGGCGGCCCATCTCACGCTCACACGTGAAGGCGTGCTCGGCGGCACCCATCTCGACGTAGGCCTGGGGATAACACCTGTCGCGGT
GCTCCTCGAAGAATCCACTGTAGCCGCCCTCGAGGATGTAGATCTCGGGGTATGTGAGGCGGGGATAGTGCTCAGCGTTGGCACTGCGGTCCTCGGCGCG
CACGTGACGGGCCATCAGCGGGGCACGGTGAGCAGAGTACTCGCAGTGGAAGACGATGAGGGTACGGCCTTCCATCGGGGTTCGGAGGAGGTGGGTAACAAGAAGGTCCTTGTCGTTGTAGTTGATGGCGCCGTCGATGTGGCCACCATCGTACTCGTACTCGAAGCGGCAGTCGATGATGAGCTTGTTATCGTATCGCTCGTTGTACTGTCCATCGAGAACGTCCAACAATGTCTGGCGTTTTATGCGAGGAATGTTGTCGCTCTCTCCTTCGGGAAAGAAATGGGGCAGGATGGGCTCGGCGGGCTCCTCAATATCCATCACAGACGAGAGAGCAGGGGCTGCTGGCGGCTCCTCCTGCTTGGGCTTCATCACCTCCCCCGAGTTCTCGAACATGCTCAACGAGCGGCGGTACTGCTTACGTGGCCGCATGAATGGGTTCGAGGGCCGCCGTGAGTGGCTTGAGATGGGCGATCCTGTGCGGGATGCGCTGCTACCATTGAGGCTAGAAAACTGAGTACGCACGCGGAGCGGTCCTGGCACGTTGGCGATCGGGCTGTTTGCGGTGGACGGCCTCTTCTCAGGAGTGGGAGAGTTCTGGAAGCATTCGCTTAAGCTGAGTGATGAGCTTTCCCTCGACAAGCTGGGGTTGCCACCAAAACGGAAGGGAGGGAGTTGGTTGTCTGGCTGACCACGAGTCAACAGGGCACTTGTAGAGTAACCCTTGGCTCGGGAGAGAGATGGTCTCCTCAGAGCAATCCTGCGACGTCTGCATTGAAACAACCAGCAAAGTCAGACGACCATATCGCAAAGCACATACGAATGGAGATGGAGCACTCACTCAGCAGCCAATGGCCTCGGCAGTTCAGCTGTTGTGGGCTGGGGAAGTGAGGGCTCAATTGAAGCGGACTCGTCCTCGGTCTTTTCTGAGGAAGCGTTGCTCTCCGTGTCGTCCATGAGTACTGGAGACTCTACCTGTGATTCACAAATCAACGAGGATGTGGCAGGCAGCTTGTGTGGGAGGGGCGAAATATCCATCATCTCCATCAGACCACCAGGCGTCGGGGATGACATTAGCGGCGGTGCCGATGTGCAGTCTTTTCGGTAAACATATTAGCTTCCCTTGTCCAGCTTCACTGTGGCAGAGTGTGCATATGTATATTAGGCTTACCACGCATGCCCATATCGCCCATGTTCATTGAGGTGAAGAGAGCTCTCCTCGGCGTGGGGAACTTGGGGCTGCTGTCCTGGTCAATACGGAAGTTCTGTCCCAAGTCAGCTGCAAGGCAGATGCTGGGCGATGAACCCCGACTGAAGTCATCTTGAAGGTAAGCCTTCTTTGAGTTGTGGATGCCCAATTGCTCTCGCAGGTTGAAGGCCCTAGGTTTGCTATCCGGAGAGTAGTGGCCAATGTTTGTCCTGTAGCCGCCGAGCCTGTCGCCAAAGAGGTGTGTGGGACGGCGAATTGCCGCCAATGGTGATGAGTCCTCCATGATTACGGGTGGTTATGCGAGTAAGGTGTTAGGTTGGAGCTGGTTCGGTATCGTGTTTCGGTCCTGTGAGCTCAATTGGTCCTGCTCTTCAAGATCTTCCTCTTGCACAATGGATGCTGCAGCAAGCTAATGCGGCAACTAGGAGGATATAAGAATTAATCGGACGTGCCGTGCCGGCCTGCGATCACAGTACGGGGAATGTTGTGTGGATTGCCGGGTCAGCATGTGCAAGCACGAAAGAGACCAAAACGGTGGTGTTGACGCGAGGGATGGTATCGACAGGAGGCTGAGTTTTATCTAGAACCGAATCCGGAGGTTTGGGGGCCGAGAACCAGCACCGAAAACCGTGCTGGATTGCACGTTATAGCTCCAAGTGTCGACAAGCAGGCATCAATTCGTCCAAACCAGGGGTGGGATTGCCGAGAAGTTGGTGGTTGAGGGATGAAGGCCGGGGTAGGTGAAAGCCGTCTAGGAGAAAGAGACGTCGAAACGAAGCTCAATTCTTTTTCCTGGTAGCAAGCTCGGTAGGCGGCGGGGCGATGCAGAGGGATGCTGTCGCTGCTGCTGCTGCTGCTGCTATTGTCGCTGCTGGACTGGGGGTCGTGACTGGCTAAAGCTAGACCTTTTAAATGCAAAGCATGAAATGCTTTATGCAAGTAAGGTGCAGGCTCGCTGTTGGCTGCTGCTGGCTCCTTTTTTGCGGGTAACACCGAAGCCTGGTTAGATTTTGCCAACTCTGGGGAAGACGAACCTCGACGACAAGAGCAACGACGAGGATTTGTTTCCGGAGAAGTCTGGTGTAGATCAAACCGGTGGGCTGTACCAAAATGCAAAGAAAGGCAGGGCAATTAAAGCAACCGACCGTCCCGTCCGACGAAGGGCTGAGGCAGGAAGAGGTAAGAGGAGAGGGATTGTCGAATTGGAGGGGACTCGCAGTACAGATAAGCGTCCTGCACGCCCAGAGGTTGCCTGGGGAGATGGGGGGTGAACGCGAGTGGGCGGTTGCCGTGAGAGCAGCAGAAAAAAAAAGCCCACTAAAAAAGTCGACTGCATGTCGTTGTTCGCACTTCCTGGCAAGCGCACCGGGCCTGTACGACTCGGGGCGGCAGCAAGGGGAGGGTAGACAAGCCAGGCTTGCCAGGGTACCGCTAACCTTGAATTTCTGAGCAAGGGCCAAGCTGCCTTACATCATCATCCAGCACGAATCAAGCTTGCCCAGCGACCAAGATCCTGATTGTCATGTTACAGGCGGGATTAAACTACGTAGGTACGGCGAAGGAGAATGCCACAGCAAGAAAACAGCAACCAAAGAATTTTTTGGTCAGATTGCGTACGTTGTAGCGCTGGAAAGCGAGATAAGATGCATGTGAAGTCTAGGTAAGGTACGCAGGTACTGTAAGGTACTCAACAGTATCGGTCGTTCTTTGAGAATGAAATTAAAATTCACACACTTTCACACGCCCCTAGTTAGTTGCTTGTCTTGGGGTGATCTTTTTCCCTACCAATTAAGAGTGTGGCGCCGGGCGATCGGTAACTGGTTGGTTGTTCTAAGAAGGCACCAAAAACAGTAAGGAAAAAAAAAAAAAGAATAGGTGCTTGGTGAATATAGCTGCCTGTCTGCCACCAACCCGCAAATGTCTCAGAAGCAGATTTCCAAGACATTGGTTCCGACAACGAGCTCCAGAACCGTGCCCACACGCCCCCAAAGTGGAATGATCTGTCTACTGTCAATTGTCCTATACTGTGGTGTTTGAGATGGCTCCCAGTGAGAACATCGTTTCCCGGACAATCGCGCAGCCTGGTCACACTCGACGCGACTTGACAACTGACTTGTGCTGACTACCTTGCAGCGCTATCTCCACCTACCTGCATGTAGCAAGCATTCGATAACTGCGGCAACGCAAGCTTACGAGAGGATATGCACCTGCAAGCGTTTCCTGGGCTAGTTCCAGCTACCTAGTTAGGGGAAGCTGCTGTAGGAACAAATGCAGCCTGGTGGATTCTTTACGTGCGTCATTCTCTACTTCGAGGCTTTTTCTTGATCAAGTGTGATAGAAATATGACGAAACTAACGCACTATGTATGCAAGTGTGTGTACCCTTTCCATTGTCTTTTTTTGAGCCCCAACTCCACTGTTACGGTAGTCGTTTTTTACGCGTCTGCTTCCAGTCACCGTCTTTAGCTACCAAGACCTATCTTATAATCACCGTTGTCTTAGAATAAAAAAAACTATACCTTGCTACGGAAGGACAATTGAACAAGGCCTGTACATACTACCCTACAAACAACCTTAGTTATTACTGTACAGCAAATAATCCGACTGCACCACTGTGTTGAGCAAATTTGGACCACACCCAACTTCCACTAGCAACCGCCGAGCTTGGCGGGGGAGCAGTCAGACTGGAGAAGAGTGGGATCCGCTGAACAAGGATCAAGCTCAGAATGGCGTTTACCCACCTTGGGGAACCAGTGGTTTAACTGTATTCTTGTTCCCGGCACAGCAACCAGCCAGGGGTGGAAAGAGAAGGCGGCTGAGGCCTGCAAGACAGGGCGTCCAGCCGCTGGGGGCATGCCTCGACAGAAGTGGAGGTCTGGCCAATAGCAGCACACAGCGGCCGCCTGGGTTCGCCCAAGCGCCGGCGAGTCCAGCACGCAAACCCCCGAACCTGCCCAATCGTTTTGCGCCGCTTCCGAAGAACCTCCAAAATGGTCACGTACCTCTATGGTCTAGGTCAAACTCGGAGAGTAACTGTAGCAATTGTTGAATTGGAGATGAGATGAGGAGCGAACGAGAGCGCCTGGAAGTGGTAAACTTATCCATGTCCCAGGGGTTCAGGAATGATTGGTGTTCCGCCGTGGACACGGTTAATTATCTATCGTTTGTCGATTACCGCCCATAATTCTACTCGGGAGGTTCCTACAGGTTGAGTGAGGTATGTAAATACTAGCCACGTCGACTTGCGGGAAGGCTGTCAATGTATGTGCCTGTGCCTGTGCCTTATTGTACTGTACTGTACAATATCAACTAGCCGAAGTGAACTGTTATATGGTAAAATTCTATCAATTGATTTTAATGGAACTATCGCAGAGACACCAAATCAAACCAATTGCACAAAGCCTCTCATTGGTTGGGCGTCCATCCGAAATGGGGTGGAAAAGAAGAAAAATTTAAGGGTCCGGTCTCCTCTACTGCACCTGTCTATGGGTTTTATTTCCTACCAACAATTCCAAAGACCAGGTCCCAAATGTCCGTGTCATCCTTACTTTTCCCCATTCGCGAAAATGCAGCCACGGACAGACTAGGCGAGAAATGGTAGTGGATGGGATGGAATGGGGGAGAACAAAATCAGGGTCCAAGCGGCTCTTCCTTCCCATGTCGCAATAATGAGGTGAGCAAAAAAAAAAAAATCGATAAAAACCTACGCTGGCTTGGCTATTCCCGCGTGATGGTAAGAGGCAAGTGTTGCGTTGATATTAAAGAGGAGCTTCGGGTGTTTCGTGATGCTGGTTTTTGCTGACCAAATGCAACGCTTTTCCCTTAAGGGGAGGGGCCTGCCAAGTAGCAATGTAACCCACACCCCCAGACTCTGTTTTTCCCTCTCAGAGTTAGCCGCGACCCAAAAGAACCCACGTTACGTAGCAAAATGGCAGGTGGCCAAGCTTGCTGACTCTGGTAATTACATAGTAGACTTTGTTTCCCAGTGGCCGTACCTAGACTGTGAATGTCTCATTGGAATTTCCCGCCGCCCAGACCCGATTACAGTCCCAGCTTGAGCCTCTTGTCACAATCGGACGGTGCTGTTGTCCACCGCTACGTAGTAGTAATCTCGGGATACGGCCCAAGCAATAGCTTTGCGGTCCGGGCTCGCACTAGCCAGGGCCCGACTCTCGGCTCATTGATTAAATTCAGAACTTATCTGGGTGGCTTAGGGCACGGTACCTGCCAGTGAGCTGTCAAAAGGCTAGGGAGAGAGGTAGTTCCAAAATCAGAAGCAATAATATCAATTGACGCACATTTTTTTATCCACATCTTCAACAAACGACTTGTGCGTTGGTTGGTTTGTCCGTTTGTTCGCCGAGTTGTACGCGTTAAGAAATTGTCCCTTGTCAGTTATACACAGTAAGCGCAAAGCCACTGACCGGGGTCTTTTTGCTCCTTTTTGAAGCTTTTATTTGATTTGCCACTGTATTGGTGGGCAAGCGACACCAACCAAATCCTCCCTGTGGGCGCATCCGGCAAAGTATTTGGCCTCTGGTCCCGGGATGGTCCTAGTCAAACAGCGAAACATTACCACGTAAGGTAGGTATGTAATTAGGTAGGTATTTCAATTTGGGTCTGGATCCAGACAGGGCTGGTTCCGGCTGCCTATACAACAGGTTCCGGAAAGGCACAAAAGTTTTCACGTCAGTGCATTTTCATTACATTCCTGAGCTTGGGCGAATGCCATGGAAACTCTTGAATTTTCTAAACAAAATTTCCCCTGGATCTTTTGTTTTACGAGCTTACTTTTTCTTGGTGTTGCTCAGGAGACTGAGGAACGCAAGTACCTGAGATACACCTGAGACATCCGGAAGAAGCAAGATGAATAATTTCAAGAAAATATGAAAAAGTACAGTGAAGCCGCCTTGGAAACGGGGTCCACCTCGAATGGCTTGCTAGCCGTTATGCAAACCGCGCGCCTTCAAGATTGCTGCAGCTGTCAGTCAGGACGTTGCTGAAGAAGGTTCGATTATGATGTCAACGACAACAATCACGGGGTATCTTTCGCGTTCTATTGTCTCTTCTCACTGGTTTTTTTTCCTACGCAGTGGGGATGGCATATTATAATGGCGGCTCGGTTTCTTCCTGTGTGGCATCTCTTAGTGCCGACCCACGGTTGGGAGATGATCGGGAATTGCAGCATCGAGAGGCAACTGGACTTTGATTAGATCGACTCTGGTCGGAGATTTGTTTCACGTATTGTAGTGAATCTCGATCGATATGCCACCAAATACAGTAAAAAAACACAACATGACAGCAAAAAAGCATTATCACTGGAGAACTCATGTCGTTGTAGCGGCGGTGGCAGCCGATTGCTAAGAACAAGCAACACGTACGTTTTTTGGTTGTTGCTTTGTATGATATTGATCAACAACAAGAGACAAACCGGCAAAACTGAATCAGACAGTCCAATCATCTGCAAACTACCAACTTTTGTCCTACATGTAAGGTACATGACAACGCAGGTACCTGCACCGAAGCTAACTTATCTACCTAGGTGTAGGTACGGCAGAGTTAGACAAGAATAGACACTATTCATTCAGTCGCCCCTCTAAGTTTTTCGACTTTTAGCCGCCTTTTCGATCCCGATCGCTCGGTCACCCGAATTGCCGTCGTCCTCCATAACTCCATCTCCTCTCCTCATTGGCCGACGTCATCATCTCCAACACCAGATAAACTATTGTTCCTCTTACCAACCCCATCCGGTTCCTCGCACATGGGATTGGTTGGATCCCGAAATCAGGATGGCCGTCAAAAGTGGTCTCTTACTGCCGACCGACTTTTCCGGAAGTCTTTGTTTACACCTTTTCCCCTTCCGTACTGTCATCACATCAGCAATCGGACGAACCCTCTCCAAGCCACCCTCCCAGCCAGACCTTACGGCTTACCTACCCCCGCGTCTAGGTCTTTTCGGGTGCAGTCAGCTCGAACGGATCGGCTTGCTCAGCCCTCCAAGCCCTCCTTGGTTTTTTTTAGGATCTGCCCTCCTCCCTCCTTTCCCACCCCGCTCCTCGAAACAGTTCGGCGTAGTACCGCATGAGACTGGGCGGTCCACAAGCGCCCAAAGGGCCCTGTCTTTGCCCGTCACCAATGAGCTTGCCTGCAGAAGTCCCTCGGTCAAGCGATGGCTTCGCTTCGCGTATTATCTAAGTTGCAGCCCAGCTGATTTGATGGATTGGGATGAGATGGAACCATTGATAACTTTGCCACGGTTACGCCCTGAACTTGTTCTCAAAGCGGACTGGCAAGAAGCGGCTAAAACCTGACTCGATCAATTGCAGATGCTACTGATATTCCTCTTTTTTTTTTTTTTTTTTTTTTTTTGTTCTGTTCACCCCCTCAGCTTGATCGACCACTCCTCTTCGTAGATGGCTAAAGCCGCTGTCAACCTACCTACCTTGTCGATGCCACACACACCGTTGATATTTCTATTATTATTCTTGTCTGTTTTGCTGTCACTTGATCTTTTTAAAAATTTCTTCTGCATCGCTACAGAAGATGCTGTGGATAAAAGTTGCTTTCATTACGTAGATTTTTCTTCTTCTTGCATGAAAATACCCTCATCGTTTCGTCGTACTGTGAGTCTTTTATGCATCTTGTCCCCCTCCAAAGTAAACAAACGAACAAAGAAAACAAAGAGAAAAAAAAAATGACGCGTTTTGTGAACAAAACAAAACAAAGGAGCTACCCCGCATCTTGGGGTGCCTCCACCGTCGCGATGTCACCTGATTTCATATAAATTTTTTCCCAAGGTCTACCAATTGGCGGTCGAAGGAGATTGAGGAGCCAAAATGGGAACGAACCAAAAGGTTAACAGAGACACATGGGACGGCGCGTAGCATTAACACAGTGACGCACATCGGGCTCAAAGTTCGTCTGCCGAGGCCAGGGCAGACAGGCTTGAAAGGTTTGACAGTTCCTCGAAAGCTTCCCTGTTCTTTTTTTAGGAAGTGCCACATTGAACCAACAAATGGAGCCAACCTGAACATGGGCCAGAAAAGAGACATGTCTCGATCCCCTGCTGCAATTTTTGCTACCAGTGGTAGAACTACAGCAAGGTACACGCACGAACTGCCTACCGTTAGTGGTAAAATGGCAAACCCGCAAGCAAAGGTACCGACACATTAGTATGATAGTGTTGTCTCGGCCTCCCTGATCCGGCACAGAGCTTGAATCCCGTGATGGCCCGCACCGTACAAGAAAGAGAGAAGGTGCAAAATTGTGCAACCGCGTCTAGCGAGCAGGTAGTCGACTATGTCAAGTTTCACGCCACAACACGGGCTGCACGCTACGGCACGCACAAGTATACATAAACGAATGTGCATTGTGCTCTCCGCGCCCCGGCAAACTCGCGTGACCACAAATAGCCGAGTAAAAATCACAGGCACTACTACTTGAGAAAACAGACCAACAAGTCCATAGAACGAGCGAGCCCGTCCGCCCGCACGTCAAGTTTCCAACCCGCGCCCTAAAAAGCCGCGATCGGAGTCGGCCGTTGTGCTGTCAGGCTAAACAAACAAGCAAGCTCGGCCGCTCGCACGGCTGCGCAGGTATCTATTCAGCTTTAGCTGGTAGGCCAGAGGTAGGCTAGCAATGGTATTATCTTGTTTGCACAACCTCATCACAGGCCTTGTGCTCGTCCCGAGGCCGAGTTTAGGACGAGTCGGGCAAAAAACAAATCCCCACGTGCGCTGGTTGTGGCTGTGCGTCAGCCCTTTGTTCCCCCGCTGTGGCCTTTCCAGAGTTGCAAAGTTCCGTGGGGGGGTCGGGTCGCGTTTGACAATCTCATGCGTGATCCGCCATTAAGCAAATTGCCAAGGTCAGAGAGCAGGCCAGACGCGATTATGGAAACCAGCAACCAGCCACCTGGTAGACGATCATCAGCCTTTCAAAAGAAACCTCAATCGACGTCTGGCGTTGCCCATCGGAACTTTTGCGCTTATTAGACAGGATACCTAACCTGCCTGGGTAGGGAGACGAACGACCCTGGAGATATTATCTGATGGTAGGCAATAATCTCATACAATGGCGCTTGGCAAAACTACTACGTGGTACGCCTTATCAGACACTAAAAGCCAACAGGAAAAGGAAGGACATGTACGTTCAATCATTGCGACCCTTCCCACCTGCCCTAGAGCAGGGAAGCACCGCACCCAAGATTGTTCGCATTATTTTTCTCTCCGTTCTCTTCGAGTGTGATTTCGATTCTCCTGGGCACAGCACGAATGCGCGCCTCGAATCAAAAATATCAAACCTCGAATGGACGTGATTTATTTGCGTTGTTCATGAGGAGAGAAGGAGAGAGAAAGTCCAAAGTGTAATTCTCGCGCGCAAGAATTTTATGGTGCGGAGAGAGTCGTAATTGGGTGCCTGACAGTTAAGGCAAGAATTCAAGCTTTTTCTGCAAGCTACCCTACCACGTTATCTGGTCCCTGAAACTGGTCCCGTCTGATGGCTCCATCTGAATTCACGTGCCCGCCTTGTCCCGCAATTGACAGACCAAGGGCCCGACGTCACCCGTTGAAGATACCGGCTCTTGAATACCGTCCACCACCGAAAGTCGAAGCAATTGTCCATTTTAACATCGCATTAAACCCATGAAGCAGCAAAGCAAGCCGCCATGAACAACCTACAAACACTCCCCCGATTCCTTCTCCCCCGTCTGAGCTGGCAGACCCCAGCCACTGCAAGCGACTGTACATTCCGCCCGGCAAGCCTCTTGCTGCGCCCATCAAAAAGGCCTCATATCCAGGAGCGGAGGGAGCCGCAGCAGCAATCTTGGGCAGGTCCCAAACGACTATTTCACACTCACAATGAAGGGCAAAGGGCGCATGCTATCGGCTTCCAGAGCCACCGATTGGCGAGGCAGCCAACGGCTTCACCCAAGCCTAGAATCCCAAGCAGCAGGAGAGCATTCCATGCCTCGCCGCCCCGCCGGAAGGATCATCACTTTGATACCCTGAAGCTGGTCCAGCGGCTGCAGAGTGAGGGCTTCACCGAGACGCAGGCAGAAGCCATGATGAAGATCTTGAACGATGTAATAGAGGAGAGGTACGCTCGCCCGCTATAGCTGCCCGGACATTGATTCCCCAGCTGGCGTCTAGCTAACACAGGAAGGTGTCTTTCACCAGCATACAAAATCTCACCCGCACAATGGTCCCGCGCGAGGACGCCGCCAAGGCCACGTACACGCAAAAGGTCGACTTTGCCAAGCTCCGCAGCGAGCTGCTGTCGACGGACAACACCGAGACCAACACGACTCGCGCCGCGCATGAGCGCCTGACTAACGACATTGCCAAGCTCAGCAGCCGGCTGCGCGACGAGATTGGCCGCACTCAGGCCAGCGTTCGCCTGGACCTGAACCTGGAGAAGGGCCGCATCCGCGAGGAGGCCGTGTCGCAGGAACTCAAGATCAAGGAGACCGAGACCAAGATCGAGCAGGAGGCCGCCGCCCTGAGGCAGCAGCTCGAGCAGGTCAAGTTCCAGACCCTGCAGTGGCTCATGGGGCTTTGCACCGGATTTGCTGCGCTCATGTTGGGTCTGTGGCGTTTGTTGATGTGAACGGGTGTCAATGCAGGACATTGTACTTTTCTATGTCTTTTTGGCTTGCTATCCGAAGCTTCGTTTCTTCATTTCTTTTTGCATATCACAGTTGGTACATAGAATATTAGAGATATAGCCATGTTTTCCTTGATTCATGGCACGAGATGGTGGGATTTACTTACAGGTCTCCACGGTCAGTAGATGACTTGCTTCAACGTGGTCATCTCGGCATTCAATAAATTTCATTTGTTGATTCTTCTACTGTTAGTGAGCCTTAGGTCTTCCTGGCGCAGTGTCATGTTAAAATGTATTATGCAGGGTTCACGAGTGAGCACAAAAAAGGAGAGAAAAAAAGAGAAAAAGCGAAGTCTTGTGGATATCAACTGGAACTTGTTTTCTATTCTAATTAATATTATCGTGTCCTAGTTCTGTCCAGGTTCATCTAGATTCTAGTCTTGTGCCTAATCATAACTTTACTCGGAAACAAAAAAAAGACATTAGCCAAACTTGTCTGCAAATGGTTTATTAGAAAGCTGGACTTGGATGTTTAACTAATATATCGTTTTAAACCCCTGATCAAGCAGTCAACTCTATCAATGGCAGAATGGTAACCATATATGCCCCATGCAATTTCCATGCCCATCGAGTACGGGGAGGATAATGTGAAAGTAGGTAAAAAAGATAGATAAACGGGGGGTTAGGTATGTAGGTGGGTAAGTACTTATGTAAAATGATATAACTGAGATGGACGTTAACATCATACGGTGGTAGGGATTTAGATGAAGAACCAGGTAATTTAAACATCCAACTTCATGTTTATATCGAGCGACCCCAGAGAGACTACTAATTACTAGAATTGACTGCTTCAAAAGTGGTCCCTTACTGTGGCATGTGGAACGCACTTATATCCAGAGCAGGAAACGCATGCCTGCATGCAAACAGGTAGGTGGGTATGAAGTATGTATTCAAAGAAATAGACAATTATGTAGGATTTTTCTTTTCGCCAACGAAAGCCTTTACACTCAACCAAGCCAACTCAACCCAACAATGAAACACCAAAAACACCGATTTCCCAATGCCTGACACTCAAAGCAAACCTCTACACCGCCTGTCTCAAAGCCCTGTGCTCCTGCCCCTTGGCCTTTCTCCTCTCCTTCTTCTTCTCAAACTTCTTTCTCTTCTCCGCGTGGTACTTGTCTCTGTTGGTGACCGCCTCAATCTTTCTCTTCTTGCCTCTCTCCTCCCTCTTCTGCTTGACCTCCTCCCCAACGTCCAGCAGTGCCCTGGTGTACGACGCCGTCCCGAACTTGTCCTGGAGCGTCTCCATGACCGTGTGAGCCTTGCCCTTGAGCGCCTCGTATTTTTCGCCAAAGTCCGGGTCTGGGGACCACGGGACGGGGATGGACGTATCGGTGAGGTTGCGCAGCGGGTGGAGGATTGTTCGCAGGTGTGGCTGCATTGTTGCCGAGGGCGCTTGGGAGCAGTAAACAGTCATAACGTCCATGGCGGCGAGCTTAGGAATGAGCTCCGCGGATCGTGGCCGGGCTTCCCTGCGCACGATGGCGGCTAGCCTTCCAAAGATGCTCGTCTCGGAGCCAGCCTTGGTCTCTGCGTCCGCGTCGTCAGATTCAGATTCTGAATCATCGTCTGTCCCCATCTCAAATTTGATGGTCTTGCCCAAGAACATGAGAATGCGAGAAACTTCCTCAGCCAGAGGCTCACTGACGCCTTCAGATAGTAAGACTTTCAGGTTCATCTGGATTAGCTCCAAGATGTCGTTCTTCTCCAGTTCAAGACCATAGGAGCCATGCATTCCGTCGGCCTTGGCAAAATCGCCCAAATATGAGCTCAGGAGCCTCACAGCCAAAAGCTTTACCGCAGGGTCGGAATGTGAGAGACAAGATTTGACTCTCTCCCAAAGCTCAGTGAGGCTGGGAACCAAAACCCTCGACGGATCCTTGTCCACCAGCTTTTGCAAAACCTTCAAAGATATCTGAGCAAGATCCGTATCGTCAAACAGGTCGGCAAGAGCCCCTGAAATCTTGCCAGTAAGCGAGCCAAAGTCCTTATTGTCCTTGCTGCTGAAATCCCTAGTCTCGAAGTAATATCCGAAAGCCTGAATGCCCAGTCCAACAACAGCTGGTTGGCTCTCTTTGCTCAGCCAGTCCCGCATGTGCACCAAGAAGGCTTGAGTTGCCGTTTTGTTCGACCGTCGAAGGATTTCTTTGACTAGCTCACCCGCAGCCAGTGTACACTTCTCGCTATCATCGTTGGCGAGCACGAGCACCAACTTGTGGAAGAAGAAGGTACATATCTCTTGTACGAAATCGTCTGCAGTCTTGATGAGTAGCAGGTGAATGACCTCCATGACAGACAGGCGGCCACCTTCGCGATCATAGTCAAGGTTTGACCGGAGGAACTTGAGCTGCTTCTGCCATCTTGCCTTCTTCTGGGGATACTCTCGGAGGAACTGGAAGTAGGCACCCCGGGCGAGATCCCTAGTATCCTTGTCGTCGTTGGTGATCATGACAGTTCCAACGTAGTCGAGTGTGTCATAAACAGCGGCAGTCTCAATCTTGCGGTCAAGCACAGACCTCAGGAAGTTAAAGGTGACGTGTCGGTGGAGCGGCTCGGTGAGATCGTCCTTGATCCTCCCAATGATCATATCGATGTCCTTGTCTTTGACGACTACCTCTCGCCTGTCCCGGAGAATGACGGATATCAACTTCAAAGCAGCCTGTGCAAGCTCCGTAGTGGAAGATACCGACGAGTTGATCGACCGCAGTGCGTCCTTCAGAGCCATGTCGTACAGAAGCTTTGAGTCGTTATTCTTGAACGGGACCTTTATGAGCACAACGAGGAGCTTGAATGCCGCAATCTTGACCTCCTCTCCATCGTCACGGACAGCATTGCCCAGATGGGGTATGAAGCCACTGATGTTGCTCGCAGTCCGAAGGCTATCGTGTTTCCTCATAAGAGATCGAAGGACATCAAATGCAAACTTCTTGAGCTTGTAGGTATGCTTGGTCGTTGTGCCGCGGTCGTTCTTCTTGGCCCCCTTTTGGATGAGGTACCGCTTGAGCTTCGGGTCGAGGGTTTTCACGGCCTCGGGCTTCTCACTGTTGATGACCTCCTGAATGACCTCATAACAAAACACCAGTGTGTCTCTGCTCTCGGCCGCCGGGTTCTGCAAAAGACCTGCAGTGATGCGGCTGAGGAGCTCGTCGATTTTCCTGACCATCTTGATATTGAGCTTCTCCATCAACAAATCCTTTAGTGGCTGCACAAGATTGATCAGGCGGCTGATGGAAGCGTTCTTGGCAATCAACTCCATCGAGTCTTGGCTCTTGCTGCTCTTGATCTCCTTCATCTTGCTGGTATACTCTTCGGCCTCCTTTTCCTGACCAGTAATACCAAAGGTGTCGTCCATGATAACCGATACGATATCACCGACACAGTAATCCAGGTCTCCCTGCTCAAACTCGGGGATGACGGCAAGGAGTAAGGAGTGCACCGTGTAGGACAGAACGTGCAGTTGGTAGCCTCGAGTGAGAGCGCCGCGAAGCTCCTTGAGAATGAAGCCAAAGCATGATGGTCCGAGAATGACGGCGATCTTGACAAGCGTCTTTCGGGCCATCTCCCTGGAGTCCCAGGCTTTGCTGCGAAGGATATGGCAGATATCTGTGAGAACGCCAGGTAGCTTGAGGTCACGCGCACTCTGGGGCAGCAAGTTCAAAAGCTTGACAACAATGATGCCCACCGGTACGCGGGAGCTGACAGTGGTCTCATCCTTCTCGTGAAGATGATCGAGCAAGGTTGTCAACAAACTTCCCGAGACTTCCTCTGTAAACTTTTCTTGGCTTGGAAGCCTCTTTGCTAATGCTAGCTTCTTCTGCGACGTTGCATCATTGCTGTCAATGTCCATAGGAGTGTTGAAGGCCTGGTTGGCAGCCAATTCGAGCGTCTCAACAATCTTGTCCAAGAGGCGGACCACTTGCTTGTGCAAGTCAGGTTTGGACTTGATGTAAGACACATATCGGCGGAGCAAAGCGCGGTATTGCGACCATTCAAGAGAGCCAGCTAAGCTTGCAATCGTGTTTGTAGCTTGTGCTCCAAGTCCTTGATCATCGCTGCCGTCCTCACGACCAAAGATGAAATGTTCAAGCAGAGGAATGAAGAACTTGCCAACATTCCTACTGCTGAGCCCGGCTCGCTCATTCACGCCTTGCAAGACCTGCAAAGCCTGAATCTGCCTGGAGACAGCTGGTGTGAGAATGTTGTAGAAAAAGTCTTGATCCCGCTTCTTAGTTTGGCGTTCGTCCTCCATGTTCATTTCGACGTCGACCGCCTCTGGCACCAAGAGCGCCAAATCTTTCACCGGCTCCCAGCATGACAAGTTAGTAGCGAGGAAGCCAAATACGCGGAGGAACTCTCTGCGCACGGCCTCAGATTCTTCTCTAGCTCCCGAATAAATCGCAGGCAGGAGGTTTCGATCCAGGATGCCCGTGTATCGCGTGCGTACTGATGGCTCATCCCAAACGGCCGAGGTTGCTTCGATAAACTTGCAGATGCCATCCGCCGCATTCTGTGCCAAGATTGCATGCTCCTCGTCGTGGTGAATGTAGTGTATAAAGTTGTGAAGCAATGGCAACCACTGGTCAACAGTGAAAGCCACATCCCTTGGATTGCAGATGGCTCGGAACGCAGCCAGTCGTTGGTCATAGTCAGGCTCATCCAGACGATTCTCAACAAAAGAGTTGAGCTGGGATGACAAATCTGCAACCTCCTGGATTGCTGGTTGCTGCGTCGCGAAGACCAGCATCAGCCTGGATAGGGCTTGGCGGTTTTGACGATCCTTGAAGAAGCTAAAAAGAGAGCAAATAGTTTGGTACAAATCATGGCGCAGCTTGTCGTCATCTTGTAAGTTTTCCAGCACAACGAAACGTTCCAAGATGAGCAGGATAGAACCCTTGACCTTGGGGTTCACGGCGCGCGCCGGTTGGTTGAGCAAGAATGTTGAGATTTGTACAAGGTTGTGAACATTCTTGGAGTTCTCGACCAACGGCGCCAACTCAACGACTGTTTCGACGGCCGCCTCAAGGAGATGCCTGCCAAGAGGGGCGAGGACCAAGGTGGTCTCGTCACCTGCGTCCCCGACATCTTCCCCTGCTGCTTGATCGTCCTTTGAATCTTCAGCCGTCTTGTCCGTCAGGCTCTCCTTGGATTGACTATTCTTGGTCTTTTCCTTGATGACAAGGTTACCAATGGTACCTAGAACCAAGTCCAGGTTTGGCTGCAGAATCTCCTCAAGAATAAGCTCGTTGAATTCAGACTCGTCCTGCGGTGCCAAGGCAAGCCTGATTAGGTTGCGAACGATCCCCAAAGCAAAAATCTTGACCTCGTCTTTGGTATGTGCCACAGAAATACAGCTGATAACCGTTGGGATGATGCGTTGGTCGTGTGAGAGCGCTAGTGCACAACGTGGCATGAGCGACCACGTTTCTAGTAGCCGTAGGATCCATGAGACACCCTGGGTTGTCTCAGAAGATAAGGTTTCAAGCTGAGGGCTGACAACCTCGGAAGCGATAACAGGAAGATACGGAGTCCAGTCAAATCCCGCAGCATTAACGAGAAGGGCACAAAGGCACTTCAGGGCTGCAGTGCGTGCTGCTCTAAGTAAAGATGTTTCGCTTGAGTTGACTTCTTCATCGTCTTCATCAGAGCTCTCGTGATCCTCCTCGTCCTCCTCAGCGTCTTGTCGTTTCTTGTCCTTGTCAGTGCGCAGGCGGCGGCACGCTGGTATCAGACAGTAGAGCACTGCGTTCACCAGCGGACCCATGTATAATGTGGCGTTGGAGCCGAGCTCGGTAATGATTGTGTCCAACATTCTCAGTAAACCAACTTGCTTGCGCGCTGGAACCAGGCTGCTAGAGATAATCTTTTGGTCAACACCGGTGCCGTCAAGTACCTGCACATCATGGATGGGTCCCAAGGCGATCTCCAAGAAGTGGCCAATGTCCTCAACATCGAGGCTGCGAATGATGGCGTTGCGGGTCCCTTGAACACCGGCCCGACCACTAGCAGCTCCTTTCTTCGAGATTGCTCTTCCGTAAAGAAGCCTAAGGAGGACTGGCATAAGCTCTGGCCTGTCCTCATCACGAATCTTCTTGTCACCCTGGAACAGAAGGGTGAGCTCGTTTCGCATTCTTGACTCCTCAAGCAACGCCTCCAAGTTTTCCTGATAGCGCTTCACTCCATCTTGCTTCCAGGCAAGGATGGCCTTGAGCGCCAGCTTTTGTACGTCGAGATCGCCATTTGACATGAGATCAAGCATCACTTTGTAGACCTGCTCATGCTGGTAGAGTACCTTGGAGTTGTGGAAGAGTGCAAAAACACCTATCAGTGCTTTGCGGTCGGCCAGGTTCCATGTTTCGTCGGCATTCACTTTTTTCTCCTCTTCTGACTCGTCGGTTTCCGCCTTGCCCGCATTATTCCAGCTGAACAAATGGGGTACCAGCTTCCGCGATCTTCGTTCAGCTACCGATGGGATTGCCGTGAGGACCTTGAGTGATTTACTCCGAGCTGTTTGTGACATGTTTGGAACAACAGCCTGCGCCTGCTCAAACTCGCTGAGCATGACGTCGAAGATCTCGTCCACGACCTTCTTTGTCATTTCAGAAGTCTCGTGAAGACTGGCAAGGTTCGTACACTCGAAATCGGTCGACCGACGGTGGTTTGATTGAATTGTAGGTTTCGGGGGACCGCTCCATCGTTGTGAGGGAACCTCAAGCCACTCAAATGCAAGTGATGCCACCATCTCCTCACCGTCCTTGGATTCCGTGATGTCTTTTAGGGCCTCCACAGCATCGTCCCATACAGGCGTGAGGCGCACCGTTATCATACCAAACATGAATGTGGGCACTGCCTTCCGCAACCAGGAGCTTTGATCTACGCTTCCATATATCTTGCCGAGCTTGCGTAGATATACAGATATTGTCCTCATGTTTGCAAGATCTAAAGGTGTCTCTTCAACTTGAAGCATAATCGCTAGTGGCGAAGAGGAGTCCTTTGGTGCAGACGGTAGCTGGTGCAAGAGTTTCAAAGAGACAAGGCGAAGATCATGGCTGTTTGTCGATAGGTTTTGGATTAGTGACTTTGTGTAGGGGTCTTCCTCCGTTTGAGGACTTTCGCTACCACTGGAACTTCCATCTTCAAGCCCTTTTGCGGCGAGTGCCTCCTCATACGCCAGAATGCTCTCCAAAAACTTGGTCAAGCGGCAGAATCTTGGCGCAGCTGCTCGCAGAAGTGGTTTGAGACTTGGGTCAACATCTCGCGCCATGCGGAGGTATGCCCGGAAGCCGGAGGTGACGATGAAATGTGCTTCATCTGTAGGTACTGATGTGGATGGCCGGAGCGCTAGCTTGAGCTTCCTGAGTAGCAATTCTGCTATCCTTGCGCTCGTGGAAGCATGTACGCCTGTCGATTCCAGGACCTTCAATAAAGCAGAGTACTTGGGCAGGCACTTGTCCCTCCACGTCTTGGGATCTTTGTCGTAAGCCCCTCTTTCGGGGAAAGGTGTTATCTCTAGCCGTTCGAACTTGCTGACAATCTGACCCTGCCATGACTCTGGCAAATGAAGACTTTCACTTCCTCCGCCGGGCTGGAGAGCACCAGACTCGACCATCTTGGGAATCAAGACGCATAGCATCTCCTCATTGTTGTCGATTGACCAATGTTTGTTGATGAATCTAAGCGAAATAGCCGGTCAGCTGACTTAAAACTGAATTTGGACTAGACATTGCCGTCGGAAAGGGGTTGACTCACTTTTGAAGGTAATCTTGAAATATACTGCGAAATCTCTCGGGATTGAGGCTCGAAAAGTAGCTACAGAAGGGGATGAAAGACCTCATGAATGGCTCTCGTGTCATGATTGCCGTCATAGTCTGTAGGGACGATATAAGAGCGTCCATAGGTGACTGATTCCACACAATGGCAATATTGACCACGATATGCTCCCATATCAGTGGCAAAGCTCCTTGGGGAAGTTTGGTTGGTGTCTTGGAGAGGGCCTGCATTGCACTGGAAAGCCCCTGGATCAAGCCTGTCCAGTTTGTGAGCCTGGTGCCGCGACGAACGCCGGCCATGGTTCCGAAAATGCGGATGCGTAGTGACAGCGACCATGGGTGGCCTTGAACATCCTCGGTGGCCACAGCCTCCTGAGTACTGGCAATGATTGCGTTCTCCAACGGGGTGAATGTCTCGGGGGTCGAGTAATGTATGGCGCTAATGAGAACGCTACAGCAAACGTCTGACCATATGGTGTTATGTTCGGCAAAGAAAGCGTCCTCAGATGGTGGCCTGAACTCTTGGTCCGGCACACAATCCACAAGACGTGTGTATATATCAGGGGCATTGGAATAAAGCGTGTGCCCTGAGCTCTTCAGAGCCTCGGCAAACATGGTCATGATGCCGTGGAAGTATAGCTCAAAGTGCTTCTCGCCAGCCTGCGCTAGCAGATCATCCCTAGCGCACTCAATCAATGATTTGAGAGATGTATCGCGGTGGGAAGGAGCTGCGGCCTTCTTGACTAGGAAACTCAACGCCTCAGCGGCAAACCTGGCGATGTACTGTGGTTGCCTCGTTCTTCCCAAAAGAGGTGCCATGGCTCGGTATGTTGGTCTCAGGTCTGGAACAAGTAGCCTAGCAAGGTACTTGAACAGAAATGCCAGAGAAGCAAACGTCCACTCGACGACCTCGGCATCTTGTGGGCGGTTTGCAAGGCCGATGATCAGCTCTAGAGCCTTGGGGTAGTGCTTCTCGAATCGAACGCCCAGATCGTGCGCAAAAGCGGTAAGAAGATCCAGCAGCGGCTCCAGAGCTTCCTTCTCGTGCAGGCTTATGTATTGTACCAGAAGCCCCATGATCTTCTCCTCAAAGTGGAGGATTTGGGGGAGGCTGTCGCATAACGGTAGCAGCTCCCTCTTGAAGGAGATGAACGGCTTGGAGAGGTTGAGGTCTGTCCATTTTTCGAGGCCGTTTCGGAGGTAGGAGGTGGTAGCGGATAGATCTTCGGATTCGAGGTCGTGCCTTCGGACCTTACGGAGGGGATCTAACGAGTGTAATTTGGAGATCTTGGTGGTGAAGGACTCCCATCGGTGCTGTTTTTGATGGGCCGTCTCTTTGGTGCCTCGGCGGGCCTTGACGATGCGCCCCGACTTTGAGACGGGCATCTTGAGGGACTGGCGTTTGATCCTCTTGTTTTCGATACAAGTAGGTTGTCCGCTCAAGACCTGCGCACGTCTAGCAAGTTACAAGGCAATTAGGGCAGGTAGTTTAACATGTCGGTGATCGATTGCAGCAACTTCCACTGGTGCCGCTTGGAAATTTTTGGTCCCAGCAGCGAAAAATCTTTATCGATAAGAACGCGTCGAGAACTTATTGCGGGGTGCATCGTTGTAGCCCACCTGATTGGAGCGCTGGAGCTCGTTGTGACATCCATGTGTAGAGCAAGCGACCCTGGTCTGATTTGAGTTCGCGCAGCGGCTAATTCGAATTCCAGCCTACTGCCATCTTTCCAAATCCTGCATCTTTTACTACGAAGTACCTACCTACCTACGTACCTTACATACCTACCTATATCTCATTGCCTGTCCGCTAGCATCTCGCATCGTTTGTGACCGGCAGGCTGCAACTGAGCATCGATGGGGTCACAACACAAAAGCAACAAACAGTCTTCGATGCCTGAGCATGCCGTCGATCCACTTGTCTTCGCCTTCCACCGGACACGTGATGCGGCATCACTTAGTACGCCTATGAATAGCCCTGTAGTCGCAATTTCCTGTCTCTGGAGCTAACGTAAAATTGTTTACTCGCTCATTATTTGGACCTTTTGCTAAAAGCTACTGCGGATCTGGCTTTGTGCCCGAGTTTTGGTCGAGAGTGGTGATAAATCCGCAGCTGACCGTGAACATGATCATTGACTATAGGACGGCAGGATGGTAGC
AGAAGGTCCTTGTCGTTGTAGTTGATGGCGCCGTCGATGTGGCCACCATCGTACTCGTACTCGAAGCGGCAGTCGATGATGAGCTTGTTATCGTATCGCT
CGTTGTACTGTCCATCGAGAACGTCCAACAATGTCTGGCGTTTTATGCGAGGAATGTTGTCGCTCTCTCCTTCGGGAAAGAAATGGGGCAGGATGGGCTC
GGCGGGCTCCTCAATATCCATCACAGACGAGAGAGCAGGGGCTGCTGGCGGCTCCTCCTGCTTGGGCTTCATCACCTCCCCCGAGTTCTCGAACATGCTC
AACGAGCGGCGGTACTGCTTACGTGGCCGCATGAATGGGTTCGAGGGCCGCCGTGAGTGGCTTGAGATGGGCGATCCTGTGCGGGATGCGCTGCTACCAT
TGAGGCTAGAAAACTGAGTACGCACGCGGAGCGGTCCTGGCACGTTGGCGATCGGGCTGTTTGCGGTGGACGGCCTCTTCTCAGGAGTGGGAGAGTTCTG
GAAGCATTCGCTTAAGCTGAGTGATGAGCTTTCCCTCGACAAGCTGGGGTTGCCACCAAAACGGAAGGGAGGGAGTTGGTTGTCTGGCTGACCACGAGTC
AACAGGGCACTTGTAGAGTAACCCTTGGCTCGGGAGAGAGATGGTCTCCTCAGAGCAATCCTGCGACGTCTGCATTGAAACAACCAGCAAAGTCAGACGA
CCATATCGCAAAGCACATACGAATGGAGATGGAGCACTCACTCAGCAGCCAATGGCCTCGGCAGTTCAGCTGTTGTGGGCTGGGGAAGTGAGGGCTCAAT
TGAAGCGGACTCGTCCTCGGTCTTTTCTGAGGAAGCGTTGCTCTCCGTGTCGTCCATGAGTACTGGAGACTCTACCTGTGATTCACAAATCAACGAGGAT
GTGGCAGGCAGCTTGTGTGGGAGGGGCGAAATATCCATCATCTCCATCAGACCACCAGGCGTCGGGGATGACATTAGCGGCGGTGCCGATGTGCAGTCTT
TTCGGTAAACATATTAGCTTCCCTTGTCCAGCTTCACTGTGGCAGAGTGTGCATATGTATATTAGGCTTACCACGCATGCCCATATCGCCCATGTTCATT
GAGGTGAAGAGAGCTCTCCTCGGCGTGGGGAACTTGGGGCTGCTGTCCTGGTCAATACGGAAGTTCTGTCCCAAGTCAGCTGCAAGGCAGATGCTGGGCG
ATGAACCCCGACTGAAGTCATCTTGAAGGTAAGCCTTCTTTGAGTTGTGGATGCCCAATTGCTCTCGCAGGTTGAAGGCCCTAGGTTTGCTATCCGGAGA
GTAGTGGCCAATGTTTGTCCTGTAGCCGCCGAGCCTGTCGCCAAAGAGGTGTGTGGGACGGCGAATTGCCGCCAATGGTGATGAGTCCTCCATGATTACG
GGTGGTTATGCGAGTAAGGTGTTAGGTTGGAGCTGGTTCGGTATCGTGTTTCGGTCCTGTGAGCTCAATTGGTCCTGCTCTTCAAGATCTTCCTCTTGCA
CAATGGATGCTGCAGCAAGCTAATGCGGCAACTAGGAGGATATAAGAATTAATCGGACGTGCCGTGCCGGCCTGCGATCACAGTACGGGGAATGTTGTGT
GGATTGCCGGGTCAGCATGTGCAAGCACGAAAGAGACCAAAACGGTGGTGTTGACGCGAGGGATGGTATCGACAGGAGGCTGAGTTTTATCTAGAACCGA
ATCCGGAGGTTTGGGGGCCGAGAACCAGCACCGAAAACCGTGCTGGATTGCACGTTATAGCTCCAAGTGTCGACAAGCAGGCATCAATTCGTCCAAACCA
GGGGTGGGATTGCCGAGAAGTTGGTGGTTGAGGGATGAAGGCCGGGGTAGGTGAAAGCCGTCTAGGAGAAAGAGACGTCGAAACGAAGCTCAATTCTTTT
TCCTGGTAGCAAGCTCGGTAGGCGGCGGGGCGATGCAGAGGGATGCTGTCGCTGCTGCTGCTGCTGCTGCTATTGTCGCTGCTGGACTGGGGGTCGTGAC
TGGCTAAAGCTAGACCTTTTAAATGCAAAGCATGAAATGCTTTATGCAAGTAAGGTGCAGGCTCGCTGTTGGCTGCTGCTGGCTCCTTTTTTGCGGGTAA
CACCGAAGCCTGGTTAGATTTTGCCAACTCTGGGGAAGACGAACCTCGACGACAAGAGCAACGACGAGGATTTGTTTCCGGAGAAGTCTGGTGTAGATCA
AACCGGTGGGCTGTACCAAAATGCAAAGAAAGGCAGGGCAATTAAAGCAACCGACCGTCCCGTCCGACGAAGGGCTGAGGCAGGAAGAGGTAAGAGGAGA
GGGATTGTCGAATTGGAGGGGACTCGCAGTACAGATAAGCGTCCTGCACGCCCAGAGGTTGCCTGGGGAGATGGGGGGTGAACGCGAGTGGGCGGTTGCC
GTGAGAGCAGCAGAAAAAAAAAGCCCACTAAAAAAGTCGACTGCATGTCGTTGTTCGCACTTCCTGGCAAGCGCACCGGGCCTGTACGACTCGGGGCGGC
AGCAAGGGGAGGGTAGACAAGCCAGGCTTGCCAGGGTACCGCTAACCTTGAATTTCTGAGCAAGGGCCAAGCTGCCTTACATCATCATCCAGCACGAATC
AAGCTTGCCCAGCGACCAAGATCCTGATTGTCATGTTACAGGCGGGATTAAACTACGTAGGTACGGCGAAGGAGAATGCCACAGCAAGAAAACAGCAACC
AAAGAATTTTTTGGTCAGATTGCGTACGTTGTAGCGCTGGAAAGCGAGATAAGATGCATGTGAAGTCTAGGTAAGGTACGCAGGTACTGTAAGGTACTCA
ACAGTATCGGTCGTTCTTTGAGAATGAAATTAAAATTCACACACTTTCACACGCCCCTAGTTAGTTGCTTGTCTTGGGGTGATCTTTTTCCCTACCAATT
AAGAGTGTGGCGCCGGGCGATCGGTAACTGGTTGGTTGTTCTAAGAAGGCACCAAAAACAGTAAGGAAAAAAAAAAAAAGAATAGGTGCTTGGTGAATAT
AGCTGCCTGTCTGCCACCAACCCGCAAATGTCTCAGAAGCAGATTTCCAAGACATTGGTTCCGACAACGAGCTCCAGAACCGTGCCCACACGCCCCCAAA
GTGGAATGATCTGTCTACTGTCAATTGTCCTATACTGTGGTGTTTGAGATGGCTCCCAGTGAGAACATCGTTTCCCGGACAATCGCGCAGCCTGGTCACA
CTCGACGCGACTTGACAACTGACTTGTGCTGACTACCTTGCAGCGCTATCTCCACCTACCTGCATGTAGCAAGCATTCGATAACTGCGGCAACGCAAGCT
TACGAGAGGATATGCACCTGCAAGCGTTTCCTGGGCTAGTTCCAGCTACCTAGTTAGGGGAAGCTGCTGTAGGAACAAATGCAGCCTGGTGGATTCTTTA
CGTGCGTCATTCTCTACTTCGAGGCTTTTTCTTGATCAAGTGTGATAGAAATATGACGAAACTAACGCACTATGTATGCAAGTGTGTGTACCCTTTCCAT
TGTCTTTTTTTGAGCCCCAACTCCACTGTTACGGTAGTCGTTTTTTACGCGTCTGCTTCCAGTCACCGTCTTTAGCTACCAAGACCTATCTTATAATCAC
CGTTGTCTTAGAATAAAAAAAACTATACCTTGCTACGGAAGGACAATTGAACAAGGCCTGTACATACTACCCTACAAACAACCTTAGTTATTACTGTACA
GCAAATAATCCGACTGCACCACTGTGTTGAGCAAATTTGGACCACACCCAACTTCCACTAGCAACCGCCGAGCTTGGCGGGGGAGCAGTCAGACTGGAGA
AGAGTGGGATCCGCTGAACAAGGATCAAGCTCAGAATGGCGTTTACCCACCTTGGGGAACCAGTGGTTTAACTGTATTCTTGTTCCCGGCACAGCAACCA
GCCAGGGGTGGAAAGAGAAGGCGGCTGAGGCCTGCAAGACAGGGCGTCCAGCCGCTGGGGGCATGCCTCGACAGAAGTGGAGGTCTGGCCAATAGCAGCA
CACAGCGGCCGCCTGGGTTCGCCCAAGCGCCGGCGAGTCCAGCACGCAAACCCCCGAACCTGCCCAATCGTTTTGCGCCGCTTCCGAAGAACCTCCAAAA
TGGTCACGTACCTCTATGGTCTAGGTCAAACTCGGAGAGTAACTGTAGCAATTGTTGAATTGGAGATGAGATGAGGAGCGAACGAGAGCGCCTGGAAGTG
GTAAACTTATCCATGTCCCAGGGGTTCAGGAATGATTGGTGTTCCGCCGTGGACACGGTTAATTATCTATCGTTTGTCGATTACCGCCCATAATTCTACT
CGGGAGGTTCCTACAGGTTGAGTGAGGTATGTAAATACTAGCCACGTCGACTTGCGGGAAGGCTGTCAATGTATGTGCCTGTGCCTGTGCCTTATTGTAC
TGTACTGTACAATATCAACTAGCCGAAGTGAACTGTTATATGGTAAAATTCTATCAATTGATTTTAATGGAACTATCGCAGAGACACCAAATCAAACCAA
TTGCACAAAGCCTCTCATTGGTTGGGCGTCCATCCGAAATGGGGTGGAAAAGAAGAAAAATTTAAGGGTCCGGTCTCCTCTACTGCACCTGTCTATGGGT
TTTATTTCCTACCAACAATTCCAAAGACCAGGTCCCAAATGTCCGTGTCATCCTTACTTTTCCCCATTCGCGAAAATGCAGCCACGGACAGACTAGGCGA
GAAATGGTAGTGGATGGGATGGAATGGGGGAGAACAAAATCAGGGTCCAAGCGGCTCTTCCTTCCCATGTCGCAATAATGAGGTGAGCAAAAAAAAAAAA
ATCGATAAAAACCTACGCTGGCTTGGCTATTCCCGCGTGATGGTAAGAGGCAAGTGTTGCGTTGATATTAAAGAGGAGCTTCGGGTGTTTCGTGATGCTG
GTTTTTGCTGACCAAATGCAACGCTTTTCCCTTAAGGGGAGGGGCCTGCCAAGTAGCAATGTAACCCACACCCCCAGACTCTGTTTTTCCCTCTCAGAGT
TAGCCGCGACCCAAAAGAACCCACGTTACGTAGCAAAATGGCAGGTGGCCAAGCTTGCTGACTCTGGTAATTACATAGTAGACTTTGTTTCCCAGTGGCC
GTACCTAGACTGTGAATGTCTCATTGGAATTTCCCGCCGCCCAGACCCGATTACAGTCCCAGCTTGAGCCTCTTGTCACAATCGGACGGTGCTGTTGTCC
ACCGCTACGTAGTAGTAATCTCGGGATACGGCCCAAGCAATAGCTTTGCGGTCCGGGCTCGCACTAGCCAGGGCCCGACTCTCGGCTCATTGATTAAATT
CAGAACTTATCTGGGTGGCTTAGGGCACGGTACCTGCCAGTGAGCTGTCAAAAGGCTAGGGAGAGAGGTAGTTCCAAAATCAGAAGCAATAATATCAATT
GACGCACATTTTTTTATCCACATCTTCAACAAACGACTTGTGCGTTGGTTGGTTTGTCCGTTTGTTCGCCGAGTTGTACGCGTTAAGAAATTGTCCCTTG
TCAGTTATACACAGTAAGCGCAAAGCCACTGACCGGGGTCTTTTTGCTCCTTTTTGAAGCTTTTATTTGATTTGCCACTGTATTGGTGGGCAAGCGACAC
CAACCAAATCCTCCCTGTGGGCGCATCCGGCAAAGTATTTGGCCTCTGGTCCCGGGATGGTCCTAGTCAAACAGCGAAACATTACCACGTAAGGTAGGTA
TGTAATTAGGTAGGTATTTCAATTTGGGTCTGGATCCAGACAGGGCTGGTTCCGGCTGCCTATACAACAGGTTCCGGAAAGGCACAAAAGTTTTCACGTC
AGTGCATTTTCATTACATTCCTGAGCTTGGGCGAATGCCATGGAAACTCTTGAATTTTCTAAACAAAATTTCCCCTGGATCTTTTGTTTTACGAGCTTAC
TTTTTCTTGGTGTTGCTCAGGAGACTGAGGAACGCAAGTACCTGAGATACACCTGAGACATCCGGAAGAAGCAAGATGAATAATTTCAAGAAAATATGAA
AAAGTACAGTGAAGCCGCCTTGGAAACGGGGTCCACCTCGAATGGCTTGCTAGCCGTTATGCAAACCGCGCGCCTTCAAGATTGCTGCAGCTGTCAGTCA
GGACGTTGCTGAAGAAGGTTCGATTATGATGTCAACGACAACAATCACGGGGTATCTTTCGCGTTCTATTGTCTCTTCTCACTGGTTTTTTTTCCTACGC
AGTGGGGATGGCATATTATAATGGCGGCTCGGTTTCTTCCTGTGTGGCATCTCTTAGTGCCGACCCACGGTTGGGAGATGATCGGGAATTGCAGCATCGA
GAGGCAACTGGACTTTGATTAGATCGACTCTGGTCGGAGATTTGTTTCACGTATTGTAGTGAATCTCGATCGATATGCCACCAAATACAGTAAAAAAACA
CAACATGACAGCAAAAAAGCATTATCACTGGAGAACTCATGTCGTTGTAGCGGCGGTGGCAGCCGATTGCTAAGAACAAGCAACACGTACGTTTTTTGGT
TGTTGCTTTGTATGATATTGATCAACAACAAGAGACAAACCGGCAAAACTGAATCAGACAGTCCAATCATCTGCAAACTACCAACTTTTGTCCTACATGT
AAGGTACATGACAACGCAGGTACCTGCACCGAAGCTAACTTATCTACCTAGGTGTAGGTACGGCAGAGTTAGACAAGAATAGACACTATTCATTCAGTCG
CCCCTCTAAGTTTTTCGACTTTTAGCCGCCTTTTCGATCCCGATCGCTCGGTCACCCGAATTGCCGTCGTCCTCCATAACTCCATCTCCTCTCCTCATTG
GCCGACGTCATCATCTCCAACACCAGATAAACTATTGTTCCTCTTACCAACCCCATCCGGTTCCTCGCACATGGGATTGGTTGGATCCCGAAATCAGGAT
GGCCGTCAAAAGTGGTCTCTTACTGCCGACCGACTTTTCCGGAAGTCTTTGTTTACACCTTTTCCCCTTCCGTACTGTCATCACATCAGCAATCGGACGA
ACCCTCTCCAAGCCACCCTCCCAGCCAGACCTTACGGCTTACCTACCCCCGCGTCTAGGTCTTTTCGGGTGCAGTCAGCTCGAACGGATCGGCTTGCTCA
GCCCTCCAAGCCCTCCTTGGTTTTTTTTAGGATCTGCCCTCCTCCCTCCTTTCCCACCCCGCTCCTCGAAACAGTTCGGCGTAGTACCGCATGAGACTGG
GCGGTCCACAAGCGCCCAAAGGGCCCTGTCTTTGCCCGTCACCAATGAGCTTGCCTGCAGAAGTCCCTCGGTCAAGCGATGGCTTCGCTTCGCGTATTAT
CTAAGTTGCAGCCCAGCTGATTTGATGGATTGGGATGAGATGGAACCATTGATAACTTTGCCACGGTTACGCCCTGAACTTGTTCTCAAAGCGGACTGGC
AAGAAGCGGCTAAAACCTGACTCGATCAATTGCAGATGCTACTGATATTCCTCTTTTTTTTTTTTTTTTTTTTTTTTTGTTCTGTTCACCCCCTCAGCTT
GATCGACCACTCCTCTTCGTAGATGGCTAAAGCCGCTGTCAACCTACCTACCTTGTCGATGCCACACACACCGTTGATATTTCTATTATTATTCTTGTCT
GTTTTGCTGTCACTTGATCTTTTTAAAAATTTCTTCTGCATCGCTACAGAAGATGCTGTGGATAAAAGTTGCTTTCATTACGTAGATTTTTCTTCTTCTT
GCATGAAAATACCCTCATCGTTTCGTCGTACTGTGAGTCTTTTATGCATCTTGTCCCCCTCCAAAGTAAACAAACGAACAAAGAAAACAAAGAGAAAAAA
AAAATGACGCGTTTTGTGAACAAAACAAAACAAAGGAGCTACCCCGCATCTTGGGGTGCCTCCACCGTCGCGATGTCACCTGATTTCATATAAATTTTTT
CCCAAGGTCTACCAATTGGCGGTCGAAGGAGATTGAGGAGCCAAAATGGGAACGAACCAAAAGGTTAACAGAGACACATGGGACGGCGCGTAGCATTAAC
ACAGTGACGCACATCGGGCTCAAAGTTCGTCTGCCGAGGCCAGGGCAGACAGGCTTGAAAGGTTTGACAGTTCCTCGAAAGCTTCCCTGTTCTTTTTTTA
GGAAGTGCCACATTGAACCAACAAATGGAGCCAACCTGAACATGGGCCAGAAAAGAGACATGTCTCGATCCCCTGCTGCAATTTTTGCTACCAGTGGTAG
AACTACAGCAAGGTACACGCACGAACTGCCTACCGTTAGTGGTAAAATGGCAAACCCGCAAGCAAAGGTACCGACACATTAGTATGATAGTGTTGTCTCG
GCCTCCCTGATCCGGCACAGAGCTTGAATCCCGTGATGGCCCGCACCGTACAAGAAAGAGAGAAGGTGCAAAATTGTGCAACCGCGTCTAGCGAGCAGGT
AGTCGACTATGTCAAGTTTCACGCCACAACACGGGCTGCACGCTACGGCACGCACAAGTATACATAAACGAATGTGCATTGTGCTCTCCGCGCCCCGGCA
AACTCGCGTGACCACAAATAGCCGAGTAAAAATCACAGGCACTACTACTTGAGAAAACAGACCAACAAGTCCATAGAACGAGCGAGCCCGTCCGCCCGCA
CGTCAAGTTTCCAACCCGCGCCCTAAAAAGCCGCGATCGGAGTCGGCCGTTGTGCTGTCAGGCTAAACAAACAAGCAAGCTCGGCCGCTCGCACGGCTGC
GCAGGTATCTATTCAGCTTTAGCTGGTAGGCCAGAGGTAGGCTAGCAATGGTATTATCTTGTTTGCACAACCTCATCACAGGCCTTGTGCTCGTCCCGAG
GCCGAGTTTAGGACGAGTCGGGCAAAAAACAAATCCCCACGTGCGCTGGTTGTGGCTGTGCGTCAGCCCTTTGTTCCCCCGCTGTGGCCTTTCCAGAGTT
GCAAAGTTCCGTGGGGGGGTCGGGTCGCGTTTGACAATCTCATGCGTGATCCGCCATTAAGCAAATTGCCAAGGTCAGAGAGCAGGCCAGACGCGATTAT
GGAAACCAGCAACCAGCCACCTGGTAGACGATCATCAGCCTTTCAAAAGAAACCTCAATCGACGTCTGGCGTTGCCCATCGGAACTTTTGCGCTTATTAG
ACAGGATACCTAACCTGCCTGGGTAGGGAGACGAACGACCCTGGAGATATTATCTGATGGTAGGCAATAATCTCATACAATGGCGCTTGGCAAAACTACT
ACGTGGTACGCCTTATCAGACACTAAAAGCCAACAGGAAAAGGAAGGACATGTACGTTCAATCATTGCGACCCTTCCCACCTGCCCTAGAGCAGGGAAGC
ACCGCACCCAAGATTGTTCGCATTATTTTTCTCTCCGTTCTCTTCGAGTGTGATTTCGATTCTCCTGGGCACAGCACGAATGCGCGCCTCGAATCAAAAA
TATCAAACCTCGAATGGACGTGATTTATTTGCGTTGTTCATGAGGAGAGAAGGAGAGAGAAAGTCCAAAGTGTAATTCTCGCGCGCAAGAATTTTATGGT
GCGGAGAGAGTCGTAATTGGGTGCCTGACAGTTAAGGCAAGAATTCAAGCTTTTTCTGCAAGCTACCCTACCACGTTATCTGGTCCCTGAAACTGGTCCC
GTCTGATGGCTCCATCTGAATTCACGTGCCCGCCTTGTCCCGCAATTGACAGACCAAGGGCCCGACGTCACCCGTTGAAGATACCGGCTCTTGAATACCG
TCCACCACCGAAAGTCGAAGCAATTGTCCATTTTAACATCGCATTAAACCCATGAAGCAGCAAAGCAAGCCGCCATGAACAACCTACAAACACTCCCCCG
ATTCCTTCTCCCCCGTCTGAGCTGGCAGACCCCAGCCACTGCAAGCGACTGTACATTCCGCCCGGCAAGCCTCTTGCTGCGCCCATCAAAAAGGCCTCAT
ATCCAGGAGCGGAGGGAGCCGCAGCAGCAATCTTGGGCAGGTCCCAAACGACTATTTCACACTCACAATGAAGGGCAAAGGGCGCATGCTATCGGCTTCC
AGAGCCACCGATTGGCGAGGCAGCCAACGGCTTCACCCAAGCCTAGAATCCCAAGCAGCAGGAGAGCATTCCATGCCTCGCCGCCCCGCCGGAAGGATCA
TCACTTTGATACCCTGAAGCTGGTCCAGCGGCTGCAGAGTGAGGGCTTCACCGAGACGCAGGCAGAAGCCATGATGAAGATCTTGAACGATGTAATAGAG
GAGAG
GTACGCTCGCCCGCTATAGCTGCCCGGACATTGATTCCCCAGCTGGCGTCTAGCTAACACAGGAAGGTGTCTTTCACCAGCATACAAAATCTCAC
CCGCACAATGGTCCCGCGCGAGGACGCCGCCAAGGCCACGTACACGCAAAAGGTCGACTTTGCCAAGCTCCGCAGCGAGCTGCTGTCGACGGACAACACC
GAGACCAACACGACTCGCGCCGCGCATGAGCGCCTGACTAACGACATTGCCAAGCTCAGCAGCCGGCTGCGCGACGAGATTGGCCGCACTCAGGCCAGCG
TTCGCCTGGACCTGAACCTGGAGAAGGGCCGCATCCGCGAGGAGGCCGTGTCGCAGGAACTCAAGATCAAGGAGACCGAGACCAAGATCGAGCAGGAGGC
CGCCGCCCTGAGGCAGCAGCTCGAGCAGGTCAAGTTCCAGACCCTGCAGTGGCTCATGGGGCTTTGCACCGGATTTGCTGCGCTCATGTTGGGTCTGTGG
CGTTTGTTGATGTGA
ACGGGTGTCAATGCAGGACATTGTACTTTTCTATGTCTTTTTGGCTTGCTATCCGAAGCTTCGTTTCTTCATTTCTTTTTGCATA
TCACAGTTGGTACATAGAATATTAGAGATATAGCCATGTTTTCCTTGATTCATGGCACGAGATGGTGGGATTTACTTACAGGTCTCCACGGTCAGTAGAT
GACTTGCTTCAACGTGGTCATCTCGGCATTCAATAAATTTCATTTGTTGATTCTTCTACTGTTAGTGAGCCTTAGGTCTTCCTGGCGCAGTGTCATGTTA
AAATGTATTATGCAGGGTTCACGAGTGAGCACAAAAAAGGAGAGAAAAAAAGAGAAAAAGCGAAGTCTTGTGGATATCAACTGGAACTTGTTTTCTATTC
TAATTAATATTATCGTGTCCTAGTTCTGTCCAGGTTCATCTAGATTCTAGTCTTGTGCCTAATCATAACTTTACTCGGAAACAAAAAAAAGACATTAGCC
AAACTTGTCTGCAAATGGTTTATTAGAAAGCTGGACTTGGATGTTTAACTAATATATCGTTTTAAACCCCTGATCAAGCAGTCAACTCTATCAATGGCAG
AATGGTAACCATATATGCCCCATGCAATTTCCATGCCCATCGAGTACGGGGAGGATAATGTGAAAGTAGGTAAAAAAGATAGATAAACGGGGGGTTAGGT
ATGTAGGTGGGTAAGTACTTATGTAAAATGATATAACTGAGATGGACGTTAACATCATACGGTGGTAGGGATTTAGATGAAGAACCAGGTAATTTAAACA
TCCAACTTCATGTTTATATCGAGCGACCCCAGAGAGACTACTAATTACTAGAATTGACTGCTTCAAAAGTGGTCCCTTACTGTGGCATGTGGAACGCACT
TATATCCAGAGCAGGAAACGCATGCCTGCATGCAAACAGGTAGGTGGGTATGAAGTATGTATTCAAAGAAATAGACAATTATGTAGGATTTTTCTTTTCG
CCAACGAAAGCCTTTACACTCAACCAAGCCAACTCAACCCAACAATGAAACACCAAAAACACCGATTTCCCAATGCCTGACACTCAAAGCAAACCTCTAC
ACCGCCTGTCTCAAAGCCCTGTGCTCCTGCCCCTTGGCCTTTCTCCTCTCCTTCTTCTTCTCAAACTTCTTTCTCTTCTCCGCGTGGTACTTGTCTCTGT
TGGTGACCGCCTCAATCTTTCTCTTCTTGCCTCTCTCCTCCCTCTTCTGCTTGACCTCCTCCCCAACGTCCAGCAGTGCCCTGGTGTACGACGCCGTCCC
GAACTTGTCCTGGAGCGTCTCCATGACCGTGTGAGCCTTGCCCTTGAGCGCCTCGTATTTTTCGCCAAAGTCCGGGTCTGGGGACCACGGGACGGGGATG
GACGTATCGGTGAGGTTGCGCAGCGGGTGGAGGATTGTTCGCAGGTGTGGCTGCATTGTTGCCGAGGGCGCTTGGGAGCAGTAAACAGTCATAACGTCCA
TGGCGGCGAGCTTAGGAATGAGCTCCGCGGATCGTGGCCGGGCTTCCCTGCGCACGATGGCGGCTAGCCTTCCAAAGATGCTCGTCTCGGAGCCAGCCTT
GGTCTCTGCGTCCGCGTCGTCAGATTCAGATTCTGAATCATCGTCTGTCCCCATCTCAAATTTGATGGTCTTGCCCAAGAACATGAGAATGCGAGAAACT
TCCTCAGCCAGAGGCTCACTGACGCCTTCAGATAGTAAGACTTTCAGGTTCATCTGGATTAGCTCCAAGATGTCGTTCTTCTCCAGTTCAAGACCATAGG
AGCCATGCATTCCGTCGGCCTTGGCAAAATCGCCCAAATATGAGCTCAGGAGCCTCACAGCCAAAAGCTTTACCGCAGGGTCGGAATGTGAGAGACAAGA
TTTGACTCTCTCCCAAAGCTCAGTGAGGCTGGGAACCAAAACCCTCGACGGATCCTTGTCCACCAGCTTTTGCAAAACCTTCAAAGATATCTGAGCAAGA
TCCGTATCGTCAAACAGGTCGGCAAGAGCCCCTGAAATCTTGCCAGTAAGCGAGCCAAAGTCCTTATTGTCCTTGCTGCTGAAATCCCTAGTCTCGAAGT
AATATCCGAAAGCCTGAATGCCCAGTCCAACAACAGCTGGTTGGCTCTCTTTGCTCAGCCAGTCCCGCATGTGCACCAAGAAGGCTTGAGTTGCCGTTTT
GTTCGACCGTCGAAGGATTTCTTTGACTAGCTCACCCGCAGCCAGTGTACACTTCTCGCTATCATCGTTGGCGAGCACGAGCACCAACTTGTGGAAGAAG
AAGGTACATATCTCTTGTACGAAATCGTCTGCAGTCTTGATGAGTAGCAGGTGAATGACCTCCATGACAGACAGGCGGCCACCTTCGCGATCATAGTCAA
GGTTTGACCGGAGGAACTTGAGCTGCTTCTGCCATCTTGCCTTCTTCTGGGGATACTCTCGGAGGAACTGGAAGTAGGCACCCCGGGCGAGATCCCTAGT
ATCCTTGTCGTCGTTGGTGATCATGACAGTTCCAACGTAGTCGAGTGTGTCATAAACAGCGGCAGTCTCAATCTTGCGGTCAAGCACAGACCTCAGGAAG
TTAAAGGTGACGTGTCGGTGGAGCGGCTCGGTGAGATCGTCCTTGATCCTCCCAATGATCATATCGATGTCCTTGTCTTTGACGACTACCTCTCGCCTGT
CCCGGAGAATGACGGATATCAACTTCAAAGCAGCCTGTGCAAGCTCCGTAGTGGAAGATACCGACGAGTTGATCGACCGCAGTGCGTCCTTCAGAGCCAT
GTCGTACAGAAGCTTTGAGTCGTTATTCTTGAACGGGACCTTTATGAGCACAACGAGGAGCTTGAATGCCGCAATCTTGACCTCCTCTCCATCGTCACGG
ACAGCATTGCCCAGATGGGGTATGAAGCCACTGATGTTGCTCGCAGTCCGAAGGCTATCGTGTTTCCTCATAAGAGATCGAAGGACATCAAATGCAAACT
TCTTGAGCTTGTAGGTATGCTTGGTCGTTGTGCCGCGGTCGTTCTTCTTGGCCCCCTTTTGGATGAGGTACCGCTTGAGCTTCGGGTCGAGGGTTTTCAC
GGCCTCGGGCTTCTCACTGTTGATGACCTCCTGAATGACCTCATAACAAAACACCAGTGTGTCTCTGCTCTCGGCCGCCGGGTTCTGCAAAAGACCTGCA
GTGATGCGGCTGAGGAGCTCGTCGATTTTCCTGACCATCTTGATATTGAGCTTCTCCATCAACAAATCCTTTAGTGGCTGCACAAGATTGATCAGGCGGC
TGATGGAAGCGTTCTTGGCAATCAACTCCATCGAGTCTTGGCTCTTGCTGCTCTTGATCTCCTTCATCTTGCTGGTATACTCTTCGGCCTCCTTTTCCTG
ACCAGTAATACCAAAGGTGTCGTCCATGATAACCGATACGATATCACCGACACAGTAATCCAGGTCTCCCTGCTCAAACTCGGGGATGACGGCAAGGAGT
AAGGAGTGCACCGTGTAGGACAGAACGTGCAGTTGGTAGCCTCGAGTGAGAGCGCCGCGAAGCTCCTTGAGAATGAAGCCAAAGCATGATGGTCCGAGAA
TGACGGCGATCTTGACAAGCGTCTTTCGGGCCATCTCCCTGGAGTCCCAGGCTTTGCTGCGAAGGATATGGCAGATATCTGTGAGAACGCCAGGTAGCTT
GAGGTCACGCGCACTCTGGGGCAGCAAGTTCAAAAGCTTGACAACAATGATGCCCACCGGTACGCGGGAGCTGACAGTGGTCTCATCCTTCTCGTGAAGA
TGATCGAGCAAGGTTGTCAACAAACTTCCCGAGACTTCCTCTGTAAACTTTTCTTGGCTTGGAAGCCTCTTTGCTAATGCTAGCTTCTTCTGCGACGTTG
CATCATTGCTGTCAATGTCCATAGGAGTGTTGAAGGCCTGGTTGGCAGCCAATTCGAGCGTCTCAACAATCTTGTCCAAGAGGCGGACCACTTGCTTGTG
CAAGTCAGGTTTGGACTTGATGTAAGACACATATCGGCGGAGCAAAGCGCGGTATTGCGACCATTCAAGAGAGCCAGCTAAGCTTGCAATCGTGTTTGTA
GCTTGTGCTCCAAGTCCTTGATCATCGCTGCCGTCCTCACGACCAAAGATGAAATGTTCAAGCAGAGGAATGAAGAACTTGCCAACATTCCTACTGCTGA
GCCCGGCTCGCTCATTCACGCCTTGCAAGACCTGCAAAGCCTGAATCTGCCTGGAGACAGCTGGTGTGAGAATGTTGTAGAAAAAGTCTTGATCCCGCTT
CTTAGTTTGGCGTTCGTCCTCCATGTTCATTTCGACGTCGACCGCCTCTGGCACCAAGAGCGCCAAATCTTTCACCGGCTCCCAGCATGACAAGTTAGTA
GCGAGGAAGCCAAATACGCGGAGGAACTCTCTGCGCACGGCCTCAGATTCTTCTCTAGCTCCCGAATAAATCGCAGGCAGGAGGTTTCGATCCAGGATGC
CCGTGTATCGCGTGCGTACTGATGGCTCATCCCAAACGGCCGAGGTTGCTTCGATAAACTTGCAGATGCCATCCGCCGCATTCTGTGCCAAGATTGCATG
CTCCTCGTCGTGGTGAATGTAGTGTATAAAGTTGTGAAGCAATGGCAACCACTGGTCAACAGTGAAAGCCACATCCCTTGGATTGCAGATGGCTCGGAAC
GCAGCCAGTCGTTGGTCATAGTCAGGCTCATCCAGACGATTCTCAACAAAAGAGTTGAGCTGGGATGACAAATCTGCAACCTCCTGGATTGCTGGTTGCT
GCGTCGCGAAGACCAGCATCAGCCTGGATAGGGCTTGGCGGTTTTGACGATCCTTGAAGAAGCTAAAAAGAGAGCAAATAGTTTGGTACAAATCATGGCG
CAGCTTGTCGTCATCTTGTAAGTTTTCCAGCACAACGAAACGTTCCAAGATGAGCAGGATAGAACCCTTGACCTTGGGGTTCACGGCGCGCGCCGGTTGG
TTGAGCAAGAATGTTGAGATTTGTACAAGGTTGTGAACATTCTTGGAGTTCTCGACCAACGGCGCCAACTCAACGACTGTTTCGACGGCCGCCTCAAGGA
GATGCCTGCCAAGAGGGGCGAGGACCAAGGTGGTCTCGTCACCTGCGTCCCCGACATCTTCCCCTGCTGCTTGATCGTCCTTTGAATCTTCAGCCGTCTT
GTCCGTCAGGCTCTCCTTGGATTGACTATTCTTGGTCTTTTCCTTGATGACAAGGTTACCAATGGTACCTAGAACCAAGTCCAGGTTTGGCTGCAGAATC
TCCTCAAGAATAAGCTCGTTGAATTCAGACTCGTCCTGCGGTGCCAAGGCAAGCCTGATTAGGTTGCGAACGATCCCCAAAGCAAAAATCTTGACCTCGT
CTTTGGTATGTGCCACAGAAATACAGCTGATAACCGTTGGGATGATGCGTTGGTCGTGTGAGAGCGCTAGTGCACAACGTGGCATGAGCGACCACGTTTC
TAGTAGCCGTAGGATCCATGAGACACCCTGGGTTGTCTCAGAAGATAAGGTTTCAAGCTGAGGGCTGACAACCTCGGAAGCGATAACAGGAAGATACGGA
GTCCAGTCAAATCCCGCAGCATTAACGAGAAGGGCACAAAGGCACTTCAGGGCTGCAGTGCGTGCTGCTCTAAGTAAAGATGTTTCGCTTGAGTTGACTT
CTTCATCGTCTTCATCAGAGCTCTCGTGATCCTCCTCGTCCTCCTCAGCGTCTTGTCGTTTCTTGTCCTTGTCAGTGCGCAGGCGGCGGCACGCTGGTAT
CAGACAGTAGAGCACTGCGTTCACCAGCGGACCCATGTATAATGTGGCGTTGGAGCCGAGCTCGGTAATGATTGTGTCCAACATTCTCAGTAAACCAACT
TGCTTGCGCGCTGGAACCAGGCTGCTAGAGATAATCTTTTGGTCAACACCGGTGCCGTCAAGTACCTGCACATCATGGATGGGTCCCAAGGCGATCTCCA
AGAAGTGGCCAATGTCCTCAACATCGAGGCTGCGAATGATGGCGTTGCGGGTCCCTTGAACACCGGCCCGACCACTAGCAGCTCCTTTCTTCGAGATTGC
TCTTCCGTAAAGAAGCCTAAGGAGGACTGGCATAAGCTCTGGCCTGTCCTCATCACGAATCTTCTTGTCACCCTGGAACAGAAGGGTGAGCTCGTTTCGC
ATTCTTGACTCCTCAAGCAACGCCTCCAAGTTTTCCTGATAGCGCTTCACTCCATCTTGCTTCCAGGCAAGGATGGCCTTGAGCGCCAGCTTTTGTACGT
CGAGATCGCCATTTGACATGAGATCAAGCATCACTTTGTAGACCTGCTCATGCTGGTAGAGTACCTTGGAGTTGTGGAAGAGTGCAAAAACACCTATCAG
TGCTTTGCGGTCGGCCAGGTTCCATGTTTCGTCGGCATTCACTTTTTTCTCCTCTTCTGACTCGTCGGTTTCCGCCTTGCCCGCATTATTCCAGCTGAAC
AAATGGGGTACCAGCTTCCGCGATCTTCGTTCAGCTACCGATGGGATTGCCGTGAGGACCTTGAGTGATTTACTCCGAGCTGTTTGTGACATGTTTGGAA
CAACAGCCTGCGCCTGCTCAAACTCGCTGAGCATGACGTCGAAGATCTCGTCCACGACCTTCTTTGTCATTTCAGAAGTCTCGTGAAGACTGGCAAGGTT
CGTACACTCGAAATCGGTCGACCGACGGTGGTTTGATTGAATTGTAGGTTTCGGGGGACCGCTCCATCGTTGTGAGGGAACCTCAAGCCACTCAAATGCA
AGTGATGCCACCATCTCCTCACCGTCCTTGGATTCCGTGATGTCTTTTAGGGCCTCCACAGCATCGTCCCATACAGGCGTGAGGCGCACCGTTATCATAC
CAAACATGAATGTGGGCACTGCCTTCCGCAACCAGGAGCTTTGATCTACGCTTCCATATATCTTGCCGAGCTTGCGTAGATATACAGATATTGTCCTCAT
GTTTGCAAGATCTAAAGGTGTCTCTTCAACTTGAAGCATAATCGCTAGTGGCGAAGAGGAGTCCTTTGGTGCAGACGGTAGCTGGTGCAAGAGTTTCAAA
GAGACAAGGCGAAGATCATGGCTGTTTGTCGATAGGTTTTGGATTAGTGACTTTGTGTAGGGGTCTTCCTCCGTTTGAGGACTTTCGCTACCACTGGAAC
TTCCATCTTCAAGCCCTTTTGCGGCGAGTGCCTCCTCATACGCCAGAATGCTCTCCAAAAACTTGGTCAAGCGGCAGAATCTTGGCGCAGCTGCTCGCAG
AAGTGGTTTGAGACTTGGGTCAACATCTCGCGCCATGCGGAGGTATGCCCGGAAGCCGGAGGTGACGATGAAATGTGCTTCATCTGTAGGTACTGATGTG
GATGGCCGGAGCGCTAGCTTGAGCTTCCTGAGTAGCAATTCTGCTATCCTTGCGCTCGTGGAAGCATGTACGCCTGTCGATTCCAGGACCTTCAATAAAG
CAGAGTACTTGGGCAGGCACTTGTCCCTCCACGTCTTGGGATCTTTGTCGTAAGCCCCTCTTTCGGGGAAAGGTGTTATCTCTAGCCGTTCGAACTTGCT
GACAATCTGACCCTGCCATGACTCTGGCAAATGAAGACTTTCACTTCCTCCGCCGGGCTGGAGAGCACCAGACTCGACCATCTTGGGAATCAAGACGCAT
AGCATCTCCTCATTGTTGTCGATTGACCAATGTTTGTTGATGAATCTAAGCGAAATAGCCGGTCAGCTGACTTAAAACTGAATTTGGACTAGACATTGCC
GTCGGAAAGGGGTTGACTCACTTTTGAAGGTAATCTTGAAATATACTGCGAAATCTCTCGGGATTGAGGCTCGAAAAGTAGCTACAGAAGGGGATGAAAG
ACCTCATGAATGGCTCTCGTGTCATGATTGCCGTCATAGTCTGTAGGGACGATATAAGAGCGTCCATAGGTGACTGATTCCACACAATGGCAATATTGAC
CACGATATGCTCCCATATCAGTGGCAAAGCTCCTTGGGGAAGTTTGGTTGGTGTCTTGGAGAGGGCCTGCATTGCACTGGAAAGCCCCTGGATCAAGCCT
GTCCAGTTTGTGAGCCTGGTGCCGCGACGAACGCCGGCCATGGTTCCGAAAATGCGGATGCGTAGTGACAGCGACCATGGGTGGCCTTGAACATCCTCGG
TGGCCACAGCCTCCTGAGTACTGGCAATGATTGCGTTCTCCAACGGGGTGAATGTCTCGGGGGTCGAGTAATGTATGGCGCTAATGAGAACGCTACAGCA
AACGTCTGACCATATGGTGTTATGTTCGGCAAAGAAAGCGTCCTCAGATGGTGGCCTGAACTCTTGGTCCGGCACACAATCCACAAGACGTGTGTATATA
TCAGGGGCATTGGAATAAAGCGTGTGCCCTGAGCTCTTCAGAGCCTCGGCAAACATGGTCATGATGCCGTGGAAGTATAGCTCAAAGTGCTTCTCGCCAG
CCTGCGCTAGCAGATCATCCCTAGCGCACTCAATCAATGATTTGAGAGATGTATCGCGGTGGGAAGGAGCTGCGGCCTTCTTGACTAGGAAACTCAACGC
CTCAGCGGCAAACCTGGCGATGTACTGTGGTTGCCTCGTTCTTCCCAAAAGAGGTGCCATGGCTCGGTATGTTGGTCTCAGGTCTGGAACAAGTAGCCTA
GCAAGGTACTTGAACAGAAATGCCAGAGAAGCAAACGTCCACTCGACGACCTCGGCATCTTGTGGGCGGTTTGCAAGGCCGATGATCAGCTCTAGAGCCT
TGGGGTAGTGCTTCTCGAATCGAACGCCCAGATCGTGCGCAAAAGCGGTAAGAAGATCCAGCAGCGGCTCCAGAGCTTCCTTCTCGTGCAGGCTTATGTA
TTGTACCAGAAGCCCCATGATCTTCTCCTCAAAGTGGAGGATTTGGGGGAGGCTGTCGCATAACGGTAGCAGCTCCCTCTTGAAGGAGATGAACGGCTTG
GAGAGGTTGAGGTCTGTCCATTTTTCGAGGCCGTTTCGGAGGTAGGAGGTGGTAGCGGATAGATCTTCGGATTCGAGGTCGTGCCTTCGGACCTTACGGA
GGGGATCTAACGAGTGTAATTTGGAGATCTTGGTGGTGAAGGACTCCCATCGGTGCTGTTTTTGATGGGCCGTCTCTTTGGTGCCTCGGCGGGCCTTGAC
GATGCGCCCCGACTTTGAGACGGGCATCTTGAGGGACTGGCGTTTGATCCTCTTGTTTTCGATACAAGTAGGTTGTCCGCTCAAGACCTGCGCACGTCTA
GCAAGTTACAAGGCAATTAGGGCAGGTAGTTTAACATGTCGGTGATCGATTGCAGCAACTTCCACTGGTGCCGCTTGGAAATTTTTGGTCCCAGCAGCGA
AAAATCTTTATCGATAAGAACGCGTCGAGAACTTATTGCGGGGTGCATCGTTGTAGCCCACCTGATTGGAGCGCTGGAGCTCGTTGTGACATCCATGTGT
AGAGCAAGCGACCCTGGTCTGATTTGAGTTCGCGCAGCGGCTAATTCGAATTCCAGCCTACTGCCATCTTTCCAAATCCTGCATCTTTTACTACGAAGTA
CCTACCTACCTACGTACCTTACATACCTACCTATATCTCATTGCCTGTCCGCTAGCATCTCGCATCGTTTGTGACCGGCAGGCTGCAACTGAGCATCGAT
GGGGTCACAACACAAAAGCAACAAACAGTCTTCGATGCCTGAGCATGCCGTCGATCCACTTGTCTTCGCCTTCCACCGGACACGTGATGCGGCATCACTT
AGTACGCCTATGAATAGCCCTGTAGTCGCAATTTCCTGTCTCTGGAGCTAACGTAAAATTGTTTACTCGCTCATTATTTGGACCTTTTGCTAAAAGCTAC
Copyright 2006 Fungal Plant Pathology Lab. & FBL
E-mail : yonglee@snu.ac.kr
Magnaporthe oryzae ATMT Database